Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 3481149
End position: 3481172
Length: 24

DNA sequence
>NC_010571, from 3481149 to 3481172 (24 bp); Opitutus terrae PB90-1 CGAGCGCGAGGGCGCGCGCGATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3480686-3481669	Sequence	Oter_2722 - oligopeptide/dipeptide ABC transporter ATPase (Protein is coded in complementary strand; from 3481669 to 3480686)