Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 3456819
End position: 3456846
Length: 28

DNA sequence
>NC_010571, from 3456819 to 3456846 (28 bp); Opitutus terrae PB90-1 GAGTTGAGAGTTGAGGGTTGAGAGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3456060-3457811	Sequence	Oter_2700 - peptide chain release factor 3 (Protein is coded in complementary strand; from 3457811 to 3456060)