Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 3403544
End position: 3403567
Length: 24

DNA sequence
>NC_010571, from 3403544 to 3403567 (24 bp); Opitutus terrae PB90-1 GACGTGGCCGTGGGCGTGGGCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3403403-3403810	Sequence	Oter_2657 - cytidine deaminase (Protein is coded in complementary strand; from 3403810 to 3403403)