Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 319053
End position: 319094
Length: 42

DNA sequence
>NC_010571, from 319053 to 319094 (42 bp); Opitutus terrae PB90-1 GCTCTCCGCTCTTCGCTCTCCGCTCTCCGCTCTCCGATCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 318165-320141	Sequence	Oter_0284 - transmembrane protein EpsH (Protein is coded in complementary strand; from 320141 to 318165)