Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 3083700
End position: 3083723
Length: 24

DNA sequence
>NC_010571, from 3083700 to 3083723 (24 bp); Opitutus terrae PB90-1 CTGCTGCTGTTGCTGCTGTTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3083359-3085194	Sequence	Oter_2395 - von Willebrand factor type A (Protein is coded in complementary strand; from 3085194 to 3083359)