Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 3076724
End position: 3076751
Length: 28

DNA sequence
>NC_010571, from 3076724 to 3076751 (28 bp); Opitutus terrae PB90-1 GAGTTGAGAGCTGAGAGTTGAGAGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3075878-3076762	Sequence	Oter_2388 - glutamyl-tRNA synthetase (Protein is coded in complementary strand; from 3076762 to 3075878)