Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 2803169
End position: 2803192
Length: 24

DNA sequence
>NC_010571, from 2803169 to 2803192 (24 bp); Opitutus terrae PB90-1 CGCGAGCGCGAGCTCGAGCGCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2803119-2803565	Sequence	Oter_2182 - DoxX family protein (Protein is coded in complementary strand; from 2803565 to 2803119)