Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 2758794
End position: 2758817
Length: 24

DNA sequence
>NC_010571, from 2758794 to 2758817 (24 bp); Opitutus terrae PB90-1 GCGAGCACGAGCGTGAGCGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2757189-2759096	Sequence	Oter_2153 - integral membrane sensor hybrid histidine kinase (Protein is coded in complementary strand; from 2759096 to 2757189)