Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 2683242
End position: 2683269
Length: 28

DNA sequence
>NC_010571, from 2683242 to 2683269 (28 bp); Opitutus terrae PB90-1 AGTTGAGAGTTGAGAGTCGAGAGTGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2682538-2686353	Sequence	Oter_2092 - DNA polymerase III subunit alpha (Protein is coded in complementary strand; from 2686353 to 2682538)