Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 2538797
End position: 2538824
Length: 28

DNA sequence
>NC_010571, from 2538797 to 2538824 (28 bp); Opitutus terrae PB90-1 GATTTTCGATTTTCGAATTTCGAATTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2538000-2539889	Sequence	Oter_1983 - ABC transporter-like protein (Protein is coded in complementary strand; from 2539889 to 2538000)