Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 2534862
End position: 2534889
Length: 28

DNA sequence
>NC_010571, from 2534862 to 2534889 (28 bp); Opitutus terrae PB90-1 GAGGGTTGAGGATTGAGCGTTGAGGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2534436-2535440	Sequence	Oter_1980 - helix-hairpin-helix DNA-binding motif-containing protein (Protein is coded in complementary strand; from 2535440 to 2534436)