Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 2416990
End position: 2417014
Length: 25

DNA sequence
>NC_010571, from 2416990 to 2417014 (25 bp); Opitutus terrae PB90-1 CCGATTCGATCAGATCCGACACGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2416863-2417693	Sequence	Oter_1922 - phosphatidate cytidylyltransferase (Protein is coded in complementary strand; from 2417693 to 2416863)