Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 223520
End position: 223547
Length: 28

DNA sequence
>NC_010571, from 223520 to 223547 (28 bp); Opitutus terrae PB90-1 GTTCGGAGTTCGGAGTTTGGAGTTCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 222883-223554	Sequence	Oter_0187 - imidazole glycerol phosphate synthase, glutamine amidotransferase subunit (Protein is coded in complementary strand; from 223554 to 222883)