Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 1876563
End position: 1876586
Length: 24

DNA sequence
>NC_010571, from 1876563 to 1876586 (24 bp); Opitutus terrae PB90-1 CGCGAGCACGAGCCCGAGCACGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1876333-1877490	Sequence	Oter_1513 - hypothetical protein (Protein is coded in complementary strand; from 1877490 to 1876333)