Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 1753338
End position: 1753365
Length: 28

DNA sequence
>NC_010571, from 1753338 to 1753365 (28 bp); Opitutus terrae PB90-1 GGCTCTCGGCTCTGGACTCTCAGCTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1753358-1754146	Sequence	Oter_1397 - hypothetical protein (Protein is coded in complementary strand; from 1754146 to 1753358)