Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 1236839
End position: 1236862
Length: 24

DNA sequence
>NC_010571, from 1236839 to 1236862 (24 bp); Opitutus terrae PB90-1 CGGCGCTGGCGCCGTCGCCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1236328-1238394	Sequence	Oter_1005 - beta-N-acetylhexosaminidase (Protein is coded in complementary strand; from 1238394 to 1236328)