Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 1058714
End position: 1058748
Length: 35

DNA sequence
>NC_010571, from 1058714 to 1058748 (35 bp); Opitutus terrae PB90-1 GTTGAGAGTTGAAAGTTGAGGGTTGAGAGTTGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1057498-1059165	Sequence	Oter_0858 - peptide synthase (Protein is coded in complementary strand; from 1059165 to 1057498)