Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 1025250
End position: 1025273
Length: 24

DNA sequence
>NC_010571, from 1025250 to 1025273 (24 bp); Opitutus terrae PB90-1 GGGCGTGGGCGCGGGGGTGGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1023973-1025328	Sequence	Oter_0838 - hypothetical protein (Protein is coded in complementary strand; from 1025328 to 1023973)