Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 2681268
End position: 2681295
Length: 28

DNA sequence
>NC_010571, from 2681268 to 2681295 (28 bp); Opitutus terrae PB90-1 CGTTGAGAGTTGAGGGTTGAGAGTTGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2681146-2682423	Sequence	Oter_2091 - Fmu (Sun) domain-containing protein (Protein is coded in complementary strand; from 2682423 to 2681146)