Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 474698
End position: 474724
Length: 27

DNA sequence
>NC_010571, from 474698 to 474724 (27 bp); Opitutus terrae PB90-1 TGCGCCGCCGGCGCCGCCCGCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 474066-475202	Sequence	Oter_0394 - flagellar P-ring protein (Protein is coded in complementary strand; from 475202 to 474066)