Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 2478896
End position: 2478919
Length: 24

DNA sequence
>NC_010571, from 2478896 to 2478919 (24 bp); Opitutus terrae PB90-1 GCGGCGGCGTCGGCGTCGACGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2474916-2482235	Sequence	Oter_1965 - amino acid adenylation domain-containing protein