Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 685677
End position: 685703
Length: 27

DNA sequence
>NC_010551, from 685677 to 685703 (27 bp); Burkholderia ambifaria MC40-6 chromosome 1 CGCCGATCGCGCCGATCGCGCCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 685616-686167	Sequence	BamMC406_0609 ruvC Holliday junction resolvase (Protein is coded in complementary strand; from 686167 to 685616)