Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 526348
End position: 526383
Length: 36

DNA sequence
>NC_010551, from 526348 to 526383 (36 bp); Burkholderia ambifaria MC40-6 chromosome 1 GCGCTGCAGGTCGCGCTCGAGGTCGAGCTGCTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 526268-527059	Sequence	BamMC406_0471 - enoyl-CoA hydratase (Protein is coded in complementary strand; from 527059 to 526268)