Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 3396088
End position: 3396111
Length: 24

DNA sequence
>NC_010551, from 3396088 to 3396111 (24 bp); Burkholderia ambifaria MC40-6 chromosome 1 CGCGGCCGCGGACGCGACCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3395834-3396535	Sequence	BamMC406_3058 - two component Fis family transcriptional regulator (Protein is coded in complementary strand; from 3396535 to 3395834)