Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 3371664
End position: 3371690
Length: 27

DNA sequence
>NC_010551, from 3371664 to 3371690 (27 bp); Burkholderia ambifaria MC40-6 chromosome 1 CAACCGCCCCAGCCGCCCCAGCCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3369727-3372714	Sequence	BamMC406_3036 - outer membrane autotransporter