Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 3345878
End position: 3345931
Length: 54

DNA sequence
>NC_010551, from 3345878 to 3345931 (54 bp); Burkholderia ambifaria MC40-6 chromosome 1 CGCTCGGCGGCGGCATCTCGCTCGGCGGCGGCATCTCGCTCGGCGGCGGCATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3344989-3348135	Sequence	BamMC406_3019 - ImpA family type VI secretion-associated protein (Protein is coded in complementary strand; from 3348135 to 3344989)