Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 2819659
End position: 2819682
Length: 24

DNA sequence
>NC_010551, from 2819659 to 2819682 (24 bp); Burkholderia ambifaria MC40-6 chromosome 1 CCGCGCCCGCGTCTGCGCCCGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2819547-2821169	Sequence	BamMC406_2539 - D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase