Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 2809789
End position: 2809833
Length: 45

DNA sequence
>NC_010551, from 2809789 to 2809833 (45 bp); Burkholderia ambifaria MC40-6 chromosome 1 GCAGCACCCGACGCACCAGCGCCCGACACAGCGGCGCCCGACGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2809723-2811021	Sequence	BamMC406_2529 - RND family efflux transporter MFP subunit (Protein is coded in complementary strand; from 2811021 to 2809723)