Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 2802529
End position: 2802573
Length: 45

DNA sequence
>NC_010551, from 2802529 to 2802573 (45 bp); Burkholderia ambifaria MC40-6 chromosome 1 CCGGCGACGGGCAATCCGGCGACGGGCAATCCGGCGACGGGCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2801404-2802915	Sequence	BamMC406_2525 - carbohydrate kinase FGGY (Protein is coded in complementary strand; from 2802915 to 2801404)