Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 2656005
End position: 2656029
Length: 25

DNA sequence
>NC_010551, from 2656005 to 2656029 (25 bp); Burkholderia ambifaria MC40-6 chromosome 1 ACGCGACGCTGCGCGACACGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2655674-2656423	Sequence	BamMC406_2387 - uroporphyrin-III C-methyltransferase (Protein is coded in complementary strand; from 2656423 to 2655674)