Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 2490470
End position: 2490505
Length: 36

DNA sequence
>NC_010551, from 2490470 to 2490505 (36 bp); Burkholderia ambifaria MC40-6 chromosome 1 GCCGCCGCGTTCACCGCCGCGTTCGCCGCCGCGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2490225-2491760	Sequence	BamMC406_2235 - DEAD/DEAH box helicase (Protein is coded in complementary strand; from 2491760 to 2490225)