Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 2457854
End position: 2457877
Length: 24

DNA sequence
>NC_010551, from 2457854 to 2457877 (24 bp); Burkholderia ambifaria MC40-6 chromosome 1 CGACCGCGACCGCGAACGCGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2457031-2458836	Sequence	BamMC406_2204 - potassium-transporting ATPase subunit A (Protein is coded in complementary strand; from 2458836 to 2457031)