Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 2168835
End position: 2168862
Length: 28

DNA sequence
>NC_010551, from 2168835 to 2168862 (28 bp); Burkholderia ambifaria MC40-6 chromosome 1 GCGCGGCGCGCGCCGCGAGGCGCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2168813-2169580	Sequence	BamMC406_1946 - peptidase M22 glycoprotease (Protein is coded in complementary strand; from 2169580 to 2168813)