Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 2125792
End position: 2125818
Length: 27

DNA sequence
>NC_010551, from 2125792 to 2125818 (27 bp); Burkholderia ambifaria MC40-6 chromosome 1 GCTGCCGGCGATGCCGGCGCTGCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2125529-2126638	Sequence	BamMC406_1911 lpxD UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase (Protein is coded in complementary strand; from 2126638 to 2125529)