Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 2079822
End position: 2079845
Length: 24

DNA sequence
>NC_010551, from 2079822 to 2079845 (24 bp); Burkholderia ambifaria MC40-6 chromosome 1 TCGTCGTCGCCGTTGTCGTCATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2077416-2079935	Sequence	BamMC406_1862 - 1A family penicillin-binding protein (Protein is coded in complementary strand; from 2079935 to 2077416)