Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 1897499
End position: 1897522
Length: 24

DNA sequence
>NC_010551, from 1897499 to 1897522 (24 bp); Burkholderia ambifaria MC40-6 chromosome 1 TTCTGCATCTGCTCCTGCATCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1897430-1897996	Sequence	BamMC406_1699 - polyhydroxyalkonate synthesis repressor PhaR (Protein is coded in complementary strand; from 1897996 to 1897430)