Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 1875541
End position: 1875585
Length: 45

DNA sequence
>NC_010551, from 1875541 to 1875585 (45 bp); Burkholderia ambifaria MC40-6 chromosome 1 GCGTCGAGGTTCGCGGCTTCGAGCGTCGCGCGGTCGGGGTTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1874587-1875777	Sequence	BamMC406_1676 - 2-nitropropane dioxygenase (Protein is coded in complementary strand; from 1875777 to 1874587)