Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 1780330
End position: 1780353
Length: 24

DNA sequence
>NC_010551, from 1780330 to 1780353 (24 bp); Burkholderia ambifaria MC40-6 chromosome 1 ATCACGACTTCACGACGTCACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1780348-1781703	Sequence	BamMC406_1588 - lysozyme (Protein is coded in complementary strand; from 1781703 to 1780348)