Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 1681702
End position: 1681731
Length: 30

DNA sequence
>NC_010551, from 1681702 to 1681731 (30 bp); Burkholderia ambifaria MC40-6 chromosome 1 TCGCGCTCGCCCGCGCGCTCGCGGTCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1681270-1682328	Sequence	BamMC406_1520 - sulfate ABC transporter ATPase