Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 1060831
End position: 1060857
Length: 27

DNA sequence
>NC_010551, from 1060831 to 1060857 (27 bp); Burkholderia ambifaria MC40-6 chromosome 1 CCGCGATCACAGCGATCATCGCGATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1060856-1062250	Sequence	BamMC406_0970 fumC fumarate hydratase (Protein is coded in complementary strand; from 1062250 to 1060856)