Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 1057704
End position: 1057730
Length: 27

DNA sequence
>NC_010551, from 1057704 to 1057730 (27 bp); Burkholderia ambifaria MC40-6 chromosome 1 TGATGTTCGTGATGTTGGTGATGTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1056371-1058941	Sequence	BamMC406_0966 - hypothetical protein (Protein is coded in complementary strand; from 1058941 to 1056371)