Sequence retrieval

Genome: Burkholderia ambifaria MC40-6 chromosome 1
Start position: 235310
End position: 235339
Length: 30

DNA sequence
>NC_010551, from 235310 to 235339 (30 bp); Burkholderia ambifaria MC40-6 chromosome 1 GCCGTCGCGCGCCTGCGCGCGCGGTTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 234636-235370	Sequence	BamMC406_0198 fliA flagellar biosynthesis sigma factor