Sequence retrieval

Genome: Polynucleobacter necessarius STIR1
Start position: 510512
End position: 510538
Length: 27

DNA sequence
>NC_010531, from 510512 to 510538 (27 bp); Polynucleobacter necessarius STIR1 AGAAGAAAGCGAAGAAAGAAAAGAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 510447-511595	Sequence	Pnec_0584 - hypothetical protein (Protein is coded in complementary strand; from 511595 to 510447)