Sequence retrieval

Genome: Polynucleobacter necessarius STIR1
Start position: 351693
End position: 351728
Length: 36

DNA sequence
>NC_010531, from 351693 to 351728 (36 bp); Polynucleobacter necessarius STIR1 ACGATTACGACCACGATTGCGATCACTATTACGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 350902-353499	Sequence	Pnec_0396 - ribonuclease, Rne/Rng family (Protein is coded in complementary strand; from 353499 to 350902)