Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 886366
End position: 886389
Length: 24

DNA sequence
>NC_010524, from 886366 to 886389 (24 bp); Leptothrix cholodnii SP-6 TGCTGCTGCTGTCGCTGCTCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 885208-887094	Sequence	Lcho_0822 - TRAP C4-dicarboxylate transport system permease DctM