Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 878801
End position: 878830
Length: 30

DNA sequence
>NC_010524, from 878801 to 878830 (30 bp); Leptothrix cholodnii SP-6 CGGCGGCGGTGGTGGCGGCGGCGGCGGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 878337-879011	Sequence	Lcho_0815 - TonB family protein (Protein is coded in complementary strand; from 879011 to 878337)