Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 808432
End position: 808458
Length: 27

DNA sequence
>NC_010524, from 808432 to 808458 (27 bp); Leptothrix cholodnii SP-6 CGCTTTCTGCGCTTTCTGCGCTTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 807179-808885	Sequence	Lcho_0751 - hypothetical protein (Protein is coded in complementary strand; from 808885 to 807179)