Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 802555
End position: 802590
Length: 36

DNA sequence
>NC_010524, from 802555 to 802590 (36 bp); Leptothrix cholodnii SP-6 TCGGGCGCGGCGTCGCGCGCGGCTTCGATCGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 802297-803070	Sequence	Lcho_0749 - glycerophosphodiester phosphodiesterase (Protein is coded in complementary strand; from 803070 to 802297)