Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 799973
End position: 800026
Length: 54

DNA sequence
>NC_010524, from 799973 to 800026 (54 bp); Leptothrix cholodnii SP-6 AGGCTCTGGAGCGGGTGCCGGCACTGGAGCCGGTGCTGGCGCTGGAGCCGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 796284-801080	Sequence	Lcho_0747 - outer membrane adhesin-like protein (Protein is coded in complementary strand; from 801080 to 796284)