Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 764251
End position: 764274
Length: 24

DNA sequence
>NC_010524, from 764251 to 764274 (24 bp); Leptothrix cholodnii SP-6 TTGGCCTCGGCCTCGGCCTTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 763732-764703	Sequence	Lcho_0715 - hypothetical protein (Protein is coded in complementary strand; from 764703 to 763732)